Return to SplicePort Homepage
Browse Acceptor Features Browse Donor Features
Predict Splice Sites

  • For more information on SplicePort see:
    SplicePort - An interactive splice-site analysis tool
    Rezarta Islamaj Dogan, Lise Getoor, W. John Wilbur and Stephen M. Mount
    Nucleic Acids Research, 2007, doi:10.1093/nar/gkm407

  • What is the acceptable sequence format?
    SplicePort accepts simple DNA/RNA sequence format as well as FASTA format.
    We advise the sequence is entered in the FASTA format. Each sequence in the FASTA format begins with a single-line description, followed by one or several line of sequence data. The description line must begin with a greater-than ( > ) symbol in the first column.

    EXAMPLE FASTA FILE:

    >Sequence description line

    ACGACCGTGACGTGCAGTAGTGGACGATTAGCTGATGCTAGCGGCGATCGATCGTCAGT
    GCAGCTGATTAGCGGCTAGCTGACTTACGCGCGGATCATTTCTAGCGTAGCTAGCTGAC
    ACGTACGGCTATTATGCTACTTAGCTGACTTATTAGGCCTATATGCGATGCTATGCTAG
    CGAGCAATCGCCTACAGTATGATTAGACTTTCGAGTCGATACTCGATGCTAGCTAGTGC
    CGATCGATTCGATTCGATTCG

  • What is the input sequence alphabet?
    The input sequence can be DNA or RNA, upper or lower case, all letters, T, U and others are accepted.

  • How long should I wait for the output?
    The user should expect a delay of 1 second per kb of submitted sequence.

  • What is the acceptable length of submitted sequences?
    We advise to contact us if you want to process sequences longer than 30,000 nucleotides.

  • Can I download the SplicePort predictions output?
    Please use the Download link to get an output of SplicePort in text format. You can use the Save button in your browser to save the file for later processing.

  • What is the SplicePort output?
    The output lists the predictions for donor and acceptor sites in the submitted sequence.
    Acceptor/Donor: Indicating the candidate splice site.
    Position: The position of the splice site in your sequence given as first (donor), or last (acceptor) nucleotide in the intron.
    Short Sequence: Gives 10 bases of sequence around the predicted site.
    Score: Gives the SplicePort computational score.
    Please consider the following figures which summarize the performance of the classification for acceptor splice sites and donor splice sites . In these figures we show the difference in sensitivity, specificity, positive predictive values (precision) and false positive rates, for each score threshold produced by our algorithm.

  • What is the difference between the output on the SplicePort website and the output for download?
    The SplicePort website offers a variety of ways of parsing, visualizing, ranking and exploring the output. This output, containing the scores for every AG and GT location in the given input sequence, is also available to download for your own records.

  • Other questions?
    Please contact us. Also let us know if you are using this web portal for your analysis. We can help you better.

    Contact